Objective: Recent studies revealed that serum Golgi protein 73 (GP73) is a novel and promising biomarker for detection of HCC (hepatocellular carcinoma) and its sensitivity and specificity in serum are superior to α-fetoprotein (AFP).So, the aim of this research is to prepare the pure anti-GP73 monoclonal antibody (mAb) with high sensitivity and specificity for detecting the serum GP73 of human, and to explore the preliminary application in early diagnosis of liver cancer.Methods: The GP73-short gene was amplified, sequenced, and subcloned intopCold Ⅱ protein expression vector digested by Nde Ⅰ and Hind Ⅲ.After therecombinant plasmid pCold Ⅱ-GP73-Short were constructed and transformed intoE.coli BL21 (DE3)with standard procedures, the fusion GP73 protein was obtained by prokaryotic recombinant expression system and purified by immobilized metal affinity chromatography.Balb/c mice were immunized with purified GP73 fusion protein and the hybridoma cell lines excreting mAbs against GP73 was obtained by fusing mouse Sp2/0 myeloma cells with spleen cells from the immunized mice.Then hybridoma cells were injected into the abdomen of Balb/c mice and ascites of Balb/c mice were purified by affinity chromatography to obtain pure mAbs against GP73.The subtypes of anti-GP73 mAbs were determined by isotyping (IgG1, IgG2a, IgG2b, IgG3, IgM, IgA) Kit, the binding specificity of anti-GP73 mAbs was characterized by ELISA, Western blot and immunohistochemical analysis after purification.To establish a newly designed double antibodysandwich ELISA (enzyme-linked immunoassay), the experimental conditions was optimized and the standard curves were obtained.Then the levels of serum GP73 in HCC group (n=64) and health group (n=60) were tested respectively.Results:According to the sequence in GenBank, the GP73-short sequences were as follows: P1, 5 GGACTTCCAGAAAGGTGTTCGC3 with the Nde Ⅰ (CATATG) restriction site; and P2, 5 CTAACGCGGGGTCATAGCAACCGTC 3 with the Hind Ⅲ (AAGCTT), which have sites for Nde Ⅰ (CATATG) and Hind Ⅲ (AAGCTT) in forward and reverse primers.GP73 recombinant protein was successfully expressed and purified.Two hybridoma cell lines against GP73 were obtained, which named 8E7, 5A10, respectively.Two mAbs tested by indirect ELISA revealed high titers (all above 1∶ 243, 000).The isotype of 8E7, 5Al0 mAbs was IgG2b, IgG1, respectively.SDS-PAGE showed that the purity of two affinity-purified anti-GP73 mAbs is over 95%.Both mAbs could combine specific to GP73 in the tests of Western blot and immunohistochemical analysis.The best experimental conditions for sandwich ELISA was selected: 5 ug/ml of 8E7 mAb as coating antibody and 1∶500 diluted HRP-5A10 used in double antibodysandwich ELISA could bring about higher absorbance and lower negative background.The relationship between OD45o and GP73 antigen concentration was obtained, it showed a very good linear response in the concentration range from 1.56 to 50 ng/mL and ELISA standard curves was calculated according to the following formula: y=0.024x+0.1894, R2=0.9966.As double antibodysandwich ELISA was successfully established, serum GP73 was tested by this method, and the results showed that serum GP73 concentrations were significantly different between HCC patients with healthy group, the level of serum GP73 in patients of HCC (171.3~384.4 ng/ml) is significantly higher than that in healthy group (37.8~88.1 ng/ml),P<0.01.Conclusion: In our research, GP73 fusion protein obtained by prokaryotic recombinant expression system was used as antigen.Anti-GP73 mAbs with high titers and specific affinity for GP73 was successfully prepared.Adouble antibodysandwich ELISA was successfully established, and then the GP73 level of serum in healthy people and HCC patients was measured by this method.ELISA results showed that the level of GP73 in HCC patients was much higher than that in healthy individuals, which demonstrated that GP73 may be a potential biomarker for the diagnosis of HCC, so the anti-GP73 mAbs prepared in our lab may be used for the preparation of the related tumor test kits.